lolo38 lolo38
  • 22-02-2016
  • History
contestada

in what region were the sentec religions predominant

Relax

Respuesta :

Bienaime12
Bienaime12 Bienaime12
  • 22-02-2016

the answer to this very important answer is that the reign is most likely to be found in india

Answer Link

Otras preguntas

Which factor should be considered when comparing and contrasting characters
What's 7 hours - 30mins ?
A certain quadratic function has x-intercepts at 2 and 3. What are the x-coordinates of its vertex? a)7/2 b)1/2 c)3/2 d)5/2
similar to or look likes of hammered metalwork​
jsfghsjgehgeujvnegeuge
John L. O'Sullivan, a newspaper reporter, said that it was the __________ of the United States to own the land from one coast to the other. A) "Manifest Destiny
At the beginning of the most recent month's operations, finished goods inventory was $30,000. The cost of goods manufactured was $326,000 and ending finished go
Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first C): ATGCTGCGAAACTTTGGCTGA Provid
what is environmental​
What process is described in the situation above? a. respiration c. feedback inhibition b. circulation d. cellular activity