montgomerybunston montgomerybunston

22-09-2020
Biology

contestada

a single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?

Relax

Respuesta :

oceanbluewater3000 oceanbluewater3000

22-09-2020

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

A pairs with T

G pairs with C

vise versa

Answer Link

Otras preguntas

Given the two sets, which statement is true? A = {1, 2} B = {1, 2, 3, 4} BcA 3cA 4cA AcB none of the above

Trouton\'s rule states that the molar enthalpy of vaporization of a liquid that does not have strong molecular interactions such as hydrogen bonding or ion-ion

Coach Taylor is trying to explain the negative side effects smoking has to athletic performance. Which of these options include both a scientific model and a co

Why was Barnett Newman's painting Cathedra attacked in 1997?

The perimeter of a rectangle is 32 centimeters. the width is 7 centimeters.

Factorise (x^2+xy)^2-(xy+y^2)^2

Which of the following statements about the effects of migration to countries in different stages of demographic transition is true? A. Migration out of a stage

Which statement describes the U.S. relationship with Iraq during the 1990s? The United States kept thousands of troops stationed in Iraq to maintain a stable g

Experts agree that for Egypt’s economy to grow, it needs to develop its _____.

Modernist poetry explored the problems that arose from rapid urbanization and industrialization in the late 1800s and early 1900s. Which lines in this excerpt f