morrisroxann5172 morrisroxann5172

25-08-2022
Business

contestada

If the level of investment spending increases by $100 and the mpc in the economy is 0.8, then the cumulative spending increase after three rounds of spending is:________

Relax

Respuesta :

Otras preguntas

Ricky scored 20 points in his first game and 18 points in his second game. He played three games during the week and averaged 21 points per game. How many point

what is oxidation number on Ni in the next compound K2[NiBr6] ???

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):

please im very impty brain today

The student takes an example of XCl2, the chloride salt of metal X, and mixes it with 100.0 mL of distilled water to form a saturated solution. The value of K_s

What is the gradient of the graph shown? Give your answer in its simplest form.

How do you know when to rewrite square trinomials and difference of squares binomials as separate factors? How can sums and differences of cubes be identified f

The presents are being opened by him

Can you help me answer this question? Increase £184 by 3%

Write an equation of the line passes through (4,1) and is parallel to y=-2x+7 .