ryandavis1289 ryandavis1289
  • 25-05-2023
  • Mathematics
contestada

.Expand each logarithm. 1) In (x^6 y^3 ) 3) log9 (3^3/7)^4)* 5) log8, (a^6 b^5) 18) log7, (x^5. y)^4)

Relax

Respuesta :

Otras preguntas

A survey shows that 67% of peanut butter lovers prefer chunky style. Out of 850 people surveyed hoe many can be predicted to say they prefer chunky style peanut
Circle the preposition in these sentences We were exhausted because our flight arrived at 4am.
What is the effect of using scaffold proteins on precision and amplification capacity in cell signaling?
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
If you drink a soda with sugar, what happens to your blood glucagon levels?
what is the solution to the following equation? 9x^2-12x+4=17
Chloe’s mother wants to have another child. However, she is concerned that a second child might also have CF, so she encourages Chloe’s stepfather to be tested.
Which muscle below is a 2nd class lever? A) Gastrocnemius B) Biceps Brachii C) Flexor carpi ulnaris D) Extensor carpi ulnaris
Which department did the US government create immediately after the 9/11 terrorist attacks
what is similarities and differences freedmen and serfs?