hopie1 hopie1
  • 23-09-2016
  • English
contestada

Conjunctions what are they and how do I write one?

Relax

Respuesta :

Ariannamarie01
Ariannamarie01 Ariannamarie01
  • 23-09-2016
Conjunction: And, but, or.
We use conjunctions to further the sentence and give more information.
How to use it: I like that shirt.
I like that shirt but it is too expensive.
We use a conjunction to add more information..
Answer Link

Otras preguntas

you just bought a new hard drive for your computer, you plan to use this secondary hard drive to store all school work files. once installed, what needs to be d
a speech is considered what type of text
How do short-term goals differ from long-term goals?
what came first the chicken or the egg
Which Of The Following Can Be Found In Breast Milk? 1. Vitamin D 2. Calcium 3. Anti Bodies 4. Iron
Distinguish between eukaryotic and prokaryotic binary fission.
Sarah's class recycled 3. 7 7/9 boxes of paper in a month. If they recycled another 9 2/8 boxes the next month what wasvthe total amount recycled
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
What hormones are related to sodium balance?
The Glorious Revolution of 1688 demonstrated that Parliament had