jay335036 jay335036

25-11-2020
Mathematics

contestada

Assume that y varies directly with x. If y= 2/5 when x= 1/3, find y when x = 1/4

Relax

Respuesta :

ddss1972 ddss1972

25-11-2020

Step-by-step explanation:

y1/x1=y2/x2

2/5÷1/3=y÷1/4

y=3/10=0.3

Answer Link

Otras preguntas

the object is moving in a circle at a constant speed in a clockwise fashion. a view from above of the circle and the objects location is shown. the vector arrow

Read the excerpt from "rebuilding the cherokee nation." what’s interesting, i think, and what gives me hope and keeps me optimistic about our people, however,

consider a fuel cell that uses the reaction ch4(g)+2o2(g)→co2(g)+2h2o(l)

All of the following individuals are EXCLUDED from the definition of an investment adviser EXCEPT a(n): A. lawyer. B. engineer. C. geologist. D. accountant

Using the following chart, which chain of amino acids would be produced by the sequence of this very short, complete mRNA: UAUUAUGCCUGAGUGAAUUGCUA?

diane purchased her house and had it assembled before it was moved to her lot. she purchased a a. condominium b. cooperative housing c. manufactured home d. sin

burt, a mentally impaired person, is asked by carl to sign a piece of paper that carl says is an autograph book. in fact, the document is a note. if later sued

The payback method is most appropriate for projects whose cash flows do not extend far into the future. True False

gross domestic product as it is commonly calculated includes estimates of the money value of the following economic activities (mark all that are correct):

13) The pet shop has 6,157 dog treats. They packed the treats into bags with 7 pieces in each bag. Any treats that did not fit into a bag of 7 were given to the