7er738txrm
7er738txrm 7er738txrm
  • 26-04-2021
  • Mathematics
contestada

5. X<5

Put it on a line plot

5 Xlt5 Put it on a line plot class=
Relax

Respuesta :

akbusiness987
akbusiness987 akbusiness987
  • 26-04-2021

Answer:

Look at the image.

Step-by-step explanation:

Ver imagen akbusiness987
Answer Link

Otras preguntas

Why were most peppered moths dark in the 1959 era but light in the 2000s?
You have 9 sweaters in your closet. 2 of them are blue. You choose one without looking. What is the probability that the sweater will not be blue? Write your an
What is the climate of Central Africa? hot dry humid temperate
PEASE HELP!! I NEED THIS DUE BY THIS FRIDAY!!!! Write a scientific argument that addresses the question: Which suspect is most likely to have made the hydroflu
Subtract: (-5x + 8) - (3x + 5)​
here's a better picture from the last one ​
Please help translate this!! I can’t understand anything! “Define the following paragraph. Mi gato se llama Pedro. Pedro no le gusta comer agua. A Pedro le gust
Is this right ??? Help plz
Can you find out a harder question my child is so smart I can’t keep up with her
2. You have the below template DNA strand. Draw the coding DNA strand and mRNA. Include which ends are 3’ and which are 5’. template DNA 3’ CCTACGGTTCGTACCCCGTA