643795
643795 643795
  • 24-09-2021
  • Mathematics
contestada

How do I solve!!!!!!!!!! plsss

How do I solve plsss class=
Relax

Respuesta :

HyperGoku HyperGoku
  • 24-09-2021
I think it might be -3
Answer Link
bhung bhung
  • 24-09-2021

Answer:

33

Step-by-step explanation:

first 3x3x3x3 = 81/9=9

9+32-50+6

15+32-50

15+18 = 33

Answer Link

Otras preguntas

A camper attaches a rope to the top of her tent to give it more support. She stakes the rope, which is 8 ft long, to the ground at a distance of 6 feet from the
0.12 to the nearest tenth
Which statements accurately describe the Battle of Guadalcanal?
please im really please of this​
Anna and Sam each want to run for president of their school's student body council. In order to do so, they must collect a certain number of signatures and get
Help help math math math
Shay constructed a scientific model of the carbon cycle. She included plants, animals, industry, fossil fuels, and the atmosphere. Which of the following arrows
list 5 benefits of goverment from sport​
3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):
What is the final temperature if it requires 5000 J of heat to warm 2.38892 x10-2 kg of water that starts at 5oC? Remember Cp for water is 4186 J/kgC