mnystrom71 mnystrom71
  • 25-11-2021
  • Mathematics
contestada

i really need some help with these!

i really need some help with these class=
Relax

Respuesta :

zinglu2004
zinglu2004 zinglu2004
  • 25-11-2021
Answer C

Explain bc E is the midpoint and AC are segment

Answer Link
ebluvw1 ebluvw1
  • 25-11-2021
The answer is the letter A
Answer Link

Otras preguntas

please help with this
another fraction problem. Have tried this one a couple of times and cant find fault in what i did
help me please please​
3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):
I need help real quick, Misty is a nail technician who travels to her clients' homes to do their manicures. The pathway in the Human Services cluster that Mist
May has 10 sticker sheets with 8 stickers each and 15 pages with y stickers each. How many stickers does she have total. A. (10 x 8) + (15y) B 10 x ( 9 + 15 +
1 minute is equal to 60 seconds. How many seconds are in 3 minutes, 37 seconds?
How to solve 8.9 times 6
A water tank is filled at a constant rate. After 36 minutes, there are 648 gallons of water in the tank. How many gallons of water flowed into the tank each min
A person is watching a boat from the top of a lighthouse.