eddavis28 eddavis28

24-01-2022
English

contestada

Why were the Israelites commanded not to work on a certain day?

Relax

Respuesta :

24-01-2022

Answer:

because the 7th day (sunday) was the sabbath and that was the holy day and the Lord God told everyone to "take a break" on that day.

Explanation:

Answer Link

Otras preguntas

Which statement best describes an advantage of indirect democracy over direct democracy? A. It can be more responsive to the interests of citizens. B. It can be

Which would most likely trigger a climate change that could lead to a mass extinction? 0 A. Volcanic outgassing o B. Earthquakes O C. Formation of a supercontin

Xavier is analyzing potential market segments. He should carefully seek potential customers who have both an interest in his products and A. a thorough knowledg

Radiant energy is a form of... A. kinetic energy only. B. neither potential nor kinetic energy. C. potential energy only. D. both potential and kinetic

Your seller wants to net $100,000 after the 5% commission is paid. Assuming no closing costs, at what price does the home need to sell for the seller to net thi

The city bus line charges $2 per adult and $1 per child to ride. During a 4-hour period a bus driver collects $1,171 from 617 riders. What is the system of equa

Question 4 (1 point) Water is ___ parts -- ------- and ___ part 1, oxygen, 4, hydrogen 2, hydrogen; 2, oxygen 1, hydrogen; 2, oxygen 2, hydrogen; 1, oxygen

Evaluate -2х2 y, if x= -3 and y= -1. -12 -18 18 12

The nineteenth-century American artist Asher Brown Durand’s painting Kindred Spirits is a particularly good example of the use of which form of perspective?

If you saw this strand of DNA how many base pairs would be in thestrand?aagcttctgaatcagttcgaagacttagtc